View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14855_low_23 (Length: 251)
Name: NF14855_low_23
Description: NF14855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14855_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 90 - 236
Target Start/End: Complemental strand, 3617046 - 3616900
Alignment:
| Q |
90 |
gttctacactcacaatgacgtgtcatgaaagttgatcttaaaaattattattaatatctgcgtgtcaatatcatatctaatgtttgtaaggtgagtgttt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3617046 |
gttctacactcacaatgacgtgtcatgaaagttgatcttaaaaattattattaatgtctgcgtgtcaatatcatatctaatgtttgtaaggtgagtgttt |
3616947 |
T |
|
| Q |
190 |
tatagttcactagatgcttaaaataatgcattgttacctggacaagg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3616946 |
tatagttcactagatgcttaaaataatgcattgttacttggacaagg |
3616900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University