View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14856_low_3 (Length: 302)
Name: NF14856_low_3
Description: NF14856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14856_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 36205314 - 36205034
Alignment:
| Q |
19 |
tagacggtctatggtctagttagtttatgtcatgattgttattttaactaaaatttcgtagtagtgctaatggaaaaacgtttgt----taaagagagac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
36205314 |
tagacggtctatggtctagttagtttatgtcatgattgttattttaactaaaatttcgtagtagtgctaatggaaaaacgtgtgtgcactaaagagagac |
36205215 |
T |
 |
| Q |
115 |
agcagcactatctactagtttcattagtttcgttggcaccactctctatcagtgtaactaaattttggaaaggttttagaaagatggtgtatgctaccaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36205214 |
agcagcactatctactagtttcattagtttcgttggcaccactctctatcagtgtaactaaattttggaaaggttttagaaatatggtgtatgctaccaa |
36205115 |
T |
 |
| Q |
215 |
tttcttaaattctatcttat------ccaaaagcatagttgaagaaaatagatccataaaagtgttgagggccatgctttt |
289 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
36205114 |
tttcttaaattctatcttatccaagaccaaaagcatagttgaagaaaatagatccataaaagtgttaaggatcatgctttt |
36205034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University