View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14857_high_3 (Length: 436)
Name: NF14857_high_3
Description: NF14857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14857_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 16 - 418
Target Start/End: Original strand, 27086887 - 27087281
Alignment:
| Q |
16 |
tattctggttcataaggttcatccacaaagccacttctgttctgtcacactttgtttggtccttctgcgtataatgcccttcataatatcaaagatactt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27086887 |
tattctggttcataaggttcatccacaaagccacttctgttctttcacactttgtttggtccttctgcgtataatgcccttcataatatcaaagatactt |
27086986 |
T |
 |
| Q |
116 |
tcttgaaaattagcattttaaatatctctatgtcaatatattttaatatagtgccaagttgttatacatgtttaaatgtttaatatacttttgttttggg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27086987 |
tcttgaaaattagcattttaaatatctctatgtcaatatattttaatatagtgccaagttgttatacatgt--------ttaatatacttttgttttggg |
27087078 |
T |
 |
| Q |
216 |
cgaggcaggttgcaggagctgctgcagctgctggtctttctcttgctgatgttgctgccgaagcaagatatgcatctgaaaatgtaggaactatgggtgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27087079 |
cgaggcaggttgcaggagctgctgcagctgctggtctttctcttgctgatgttgctgccgaagcaagatatgcatctgaaaatgtaggaactatgggtgt |
27087178 |
T |
 |
| Q |
316 |
tgctttaaaagcttgcacactccctggtagggttttaacagatcgtttgggggcatcaaaaatggaactgggtcttggaattgtaagtttcctttagaca |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27087179 |
tgctttaaaagcttgcacactccctggtagggttttaacagatcgtttgggggcatcaaaaatggaactgggtcttggaattgtaagtttcctttagaca |
27087278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University