View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14857_low_19 (Length: 229)
Name: NF14857_low_19
Description: NF14857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14857_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 46476633 - 46476435
Alignment:
| Q |
13 |
aagaatatatcacttactatgcttctaaatttgaaaagacaggattcagtggtgcccttaactactatagaaatcttaacttgtaagtcctatcattttt |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46476633 |
aagaagatatcacttactatgcttctaaatttgaaaagacaggattcagtggtgcccttaactactatagaaatcttaacttgtaagtcctatcattttt |
46476534 |
T |
|
| Q |
113 |
ccaaattaactaggtgccccttgtgcatcattcacgtaccacttatacaggtccggttgaaggttcaaacctgggtcaagcaggatatgaagccctctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46476533 |
ccaaattaactaggtgccccttgtgcatcattcacgtaccacttatacaggtccggttgaaggttcaaacctgggtcaagcaggatatgaagccctctt |
46476435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 25 - 103
Target Start/End: Complemental strand, 46514786 - 46514708
Alignment:
| Q |
25 |
cttactatgcttctaaatttgaaaagacaggattcagtggtgcccttaactactatagaaatcttaacttgtaagtcct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||| |||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
46514786 |
cttactatgcttctaaatttgaaaagactggatttagtggtggccttaacttctacagaaatctcaacttgtaagtcct |
46514708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 25 - 103
Target Start/End: Complemental strand, 46493517 - 46493439
Alignment:
| Q |
25 |
cttactatgcttctaaatttgaaaagacaggattcagtggtgcccttaactactatagaaatcttaacttgtaagtcct |
103 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||| ||||||| |||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
46493517 |
cttattatgcatctaaatttgaaaagactggatttagtggtggccttaacttctacagaaatctcaacttgtaagtcct |
46493439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 46484088 - 46484012
Alignment:
| Q |
25 |
cttactatgcttctaaatttgaaaagacaggattcagtggtgcccttaactactatagaaatcttaacttgtaagtc |
101 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||| |||| ||||||||||| |||||| | |||||||||||| |
|
|
| T |
46484088 |
cttactatgcttccaaatttgaacagacaggattcagcggtggtcttaactactacagaaatttcaacttgtaagtc |
46484012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University