View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14858_low_25 (Length: 213)
Name: NF14858_low_25
Description: NF14858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14858_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 211
Target Start/End: Original strand, 44934423 - 44934618
Alignment:
| Q |
16 |
aatactggtcacatctcacaatcccaaataaatatcatttagccgcgaatacaaaaatacacatcatttaaatagtttctttaagtagattttctttagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44934423 |
aatactggtcacatctcacaatcccaaataaatatcatttagccgcgaatacaaaaatacacatcatttaaatagtttctttaagtagattttctttagt |
44934522 |
T |
 |
| Q |
116 |
gagctttggtttagtttatgttttgtaacaaataatttagtttatagtttattaacaagtttttcttattagtttatagctttcacattttctctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44934523 |
gagctttggtttagtttatgttttgtaacaaataatttagtttatagtttattaacaagtttttcttattagtttatagctttcacattttctctc |
44934618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University