View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14859_low_5 (Length: 237)
Name: NF14859_low_5
Description: NF14859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14859_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4223805 - 4223586
Alignment:
| Q |
1 |
ttttcgagtttaccagcataaactgttcctaaacgaccttttccaatgatactcctatggttgaagccatttgtagcaatatcaataactgttaaagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4223805 |
ttttcgagtttaccagcataaactgttcctaaacgaccttttccaatgattctcctatggttgaagccatttgtagcaatatcaataactgttaaagggt |
4223706 |
T |
 |
| Q |
101 |
atacaagagcactttgtttcactggaagtgtttcttctgattcaactggtttcttcttgcaagcaaaaaagaggaaaataccaagaatcatgagagatat |
200 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4223705 |
ataaaagagcaatttgtttcactggaagtgtttcttctgattcaactggtttcttcttgcaagaaaaaaagaggaaaataccaagaattatgagagatat |
4223606 |
T |
 |
| Q |
201 |
tgatagaattgccatgactg |
220 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
4223605 |
tgatagaatagccatgactg |
4223586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University