View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14859_low_6 (Length: 235)
Name: NF14859_low_6
Description: NF14859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14859_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 9 - 153
Target Start/End: Complemental strand, 980463 - 980319
Alignment:
| Q |
9 |
caaaggccaatggatttgtccaaaatgtgagtatgttaactttgccttcagaaccaaatgcaacatcaaacactgtagatctgacaaacctgtaagtgtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
980463 |
caaaggccaatggatttgtccaaaatgtgagtatgttaactttgccttcagaaccaaatgcaacatcaaacactgtagagctgacaaacctgtaagtgtg |
980364 |
T |
 |
| Q |
109 |
ttttcacttgcgttttaatgcttaaatatatgattatgttatgaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980363 |
ttttcacttgcgttttaatgcttaaatatatgattatgttatgaa |
980319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University