View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1485_high_11 (Length: 293)
Name: NF1485_high_11
Description: NF1485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1485_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 36970838 - 36971102
Alignment:
| Q |
19 |
acaagtaccttccaatagcttcagcatagttgtcaaaccctaacgaacacagagcccaacagatatcatccccattaacggtcttgcgattctccttgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36970838 |
acaagtaccttccaatagcttcagcatagttgtcaaaccctaacgaacacagagcccaacagatatcgtccccattaacggtcttgcgattctccttgtg |
36970937 |
T |
|
| Q |
119 |
acacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcgcacattcttgcatcaactgtttgctttcttttgagatctttgcattgggagga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36970938 |
acacttgtcagatgcttcacctgtcacgaaacttatgaattctgtcgcacattcttgcatcaactgtttgctttcttttgagatctttgcattgggagga |
36971037 |
T |
|
| Q |
219 |
agattttgcttcattattctacccacattcgctatgggcaacgttttatctccttcatcgttcat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36971038 |
agattttgcttcattattctacccacattcgctatgggcaacgttttatctccctcatcgttcat |
36971102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 71 - 139
Target Start/End: Original strand, 39786313 - 39786381
Alignment:
| Q |
71 |
agcccaacagatatcatccccattaacggtcttgcgattctccttgtgacacttgtcagatgcttcacc |
139 |
Q |
| |
|
||||||||| | |||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39786313 |
agcccaacaaacatcatcaccattcactgtcttgcgcttctccttgtgacacttgtcagatgcttcacc |
39786381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 108 - 179
Target Start/End: Complemental strand, 56068049 - 56067978
Alignment:
| Q |
108 |
ttctccttgtgacacttgtcagatgcttcacctgtcacgaaacttatgaactctgtcgcacattcttgcatc |
179 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||| | ||| ||||||||||||| |||| ||||||||| |
|
|
| T |
56068049 |
ttctctttctgacacttttcagatgcttcacctgttatgaagcttatgaactctgatacacactcttgcatc |
56067978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University