View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1485_low_20 (Length: 253)
Name: NF1485_low_20
Description: NF1485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1485_low_20 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 17262597 - 17262362
Alignment:
| Q |
13 |
gagatgaaggataggacattagtttttcctccatgctctaactgatttttctgcattgtgatggtttgattttctttacctattgtcttgatgaccaata |
112 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
17262597 |
gagaagaagggtaggacattagtttttcctccatgctctaactgatttttctgcattgtgatggtttga----gtttacctattgtcttgatgaccgata |
17262502 |
T |
 |
| Q |
113 |
caatcacgccttttttgatggatgaaatgtatattagtagnnnnnnnnnnnnnnnnnnnnnnnnctattgacttcacaattcagataatagagtgacaaa |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17262501 |
aaatcacgcc-tttttgatggatgaaatgtatattagtagttttaactttttttctttctttttctattgacttcacacttcagataatagagtgacaaa |
17262403 |
T |
 |
| Q |
213 |
tgacgatgcgatgctgaaaatctcacgatgaaagttgattt |
253 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17262402 |
tgaagatgcgatgctgaaaatctcacgatgaaagttgattt |
17262362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University