View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1485_low_30 (Length: 235)
Name: NF1485_low_30
Description: NF1485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1485_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8176089 - 8176314
Alignment:
| Q |
1 |
aacggtagcacaaggaagtatttatcttttaacaatggcagaga-ttagagttaacttcaaagaaattcttgtcttgccttaaagacacaaatccatgtc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || | |||| |
|
|
| T |
8176089 |
aacggtagcacaaggaagtatttatcttttaacaatggcagagagttagagttaacttcaaagaaattcttgtcttgccttaaagaca--aacctatgtg |
8176186 |
T |
 |
| Q |
100 |
ggcgtccagagccagtctctgcccgctgcacacataacagatgaaaaacaaaggaatatcaaaacgcat------cataaagacggaggtgcacatgtct |
193 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| | ||| |
|
|
| T |
8176187 |
ggcggcaagagccagtctctgcccgctgcacacataacagatgaaaaacaaaggaatatcaaaacgcatcatctccataaacacggaggtgcacttttct |
8176286 |
T |
 |
| Q |
194 |
caactattctctgcccaaagtcataagt |
221 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
8176287 |
caactatgctctgcccaaagtcataagt |
8176314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University