View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1485_low_32 (Length: 206)
Name: NF1485_low_32
Description: NF1485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1485_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 13 - 192
Target Start/End: Complemental strand, 40071854 - 40071675
Alignment:
| Q |
13 |
aatatgtgtaaattttagacaatgtttatgactttgtcgatatacccacaaaatatcaaatcttgtatatgtattatagctacatcagtacgannnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40071854 |
aatatgtgtaaattttagacaatgtttatgacttcgtcgatatacccacaaaatatcaaatcttgtataagtattatagctacatcaatacgattttttt |
40071755 |
T |
|
| Q |
113 |
nnaaaccgtcgttaaaaagattttttcttgtaaaccttgttagaagacttttcaagaaactcaattttaatataaaatct |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40071754 |
ttaaaccgtcgttaaaaagaatttttcttgtaaaccttgttagaagacttttcaagaaactcaattttaatataaaatct |
40071675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University