View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14860_high_4 (Length: 252)
Name: NF14860_high_4
Description: NF14860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14860_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 42677265 - 42677019
Alignment:
| Q |
1 |
ttctcaatctcttgatggttccaaattgtccaaaataagcttccgccatctccatctctttgaagccatgtggaatcaacccaatatacaaaacatggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42677265 |
ttctcaatctcttgatggttccaaattgtccaaaataagctttcgccatctccatctcttagaagccatgtggaatcaaaccaatatacaaaacatggga |
42677166 |
T |
|
| Q |
101 |
agtattctccaatggtttgcggctaggaccagcttccaacgacaaaaaatcagcaccatgctcaaatggaaaaaattaaatggcaatggctttataccac |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
42677165 |
agtattctccaatggtttgcgactaggaccagcttccaacgacaaaaaatcagcaccatgctcaaatggatagaattaaatggcaatggctttataccac |
42677066 |
T |
|
| Q |
201 |
acgaaagagatctgattacactaaaacatattcgctttgatattctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42677065 |
acgaaagagatctgattacactaaaacatattcgctttgattttctt |
42677019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 52835007 - 52834967
Alignment:
| Q |
1 |
ttctcaatctcttgatggttccaaattgtccaaaataagct |
41 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
52835007 |
ttctcaatctcttgacggtaccgaattgtccaaaataagct |
52834967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 48969541 - 48969581
Alignment:
| Q |
1 |
ttctcaatctcttgatggttccaaattgtccaaaataagct |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48969541 |
ttctcaatctcttgatggttccaaattgtccaaaataagct |
48969581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 46 - 118
Target Start/End: Original strand, 48969712 - 48969784
Alignment:
| Q |
46 |
ccatctccatctctttgaagccatgtggaatcaacccaatatacaaaacatgggaagtattctccaatggttt |
118 |
Q |
| |
|
|||||||| |||| | |||||||||||||||| ||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
48969712 |
ccatctccttctcatagaagccatgtggaatccgaccaatatacaaaacaggggaagaattctccaattgttt |
48969784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University