View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14861_high_18 (Length: 307)
Name: NF14861_high_18
Description: NF14861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14861_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 64 - 286
Target Start/End: Complemental strand, 44885071 - 44884851
Alignment:
| Q |
64 |
tgtgtaatttttataagatttcgtttatgtccagatttgtgtcatttggccacattcaatgaatattttgcacaataatttaatttgatttgtgttgcca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44885071 |
tgtgtaatttttataagatttcgtttatgtccagatttgtgtcatttggccacattcaatgaatattttgcacaataatttaatttgatttgtgttgcca |
44884972 |
T |
 |
| Q |
164 |
aatcgacatatatttgccacaaaagggggctgttccccgtcataaagaggtttaacctctatatgctgatgcaaggttttacgagtttttagtggattta |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44884971 |
aatcgacatatatttgccacaaaagggggctgttccccgtcataaagaggtttaacctc--tatgctgatgcaaggttttacgagtttttagtggattta |
44884874 |
T |
 |
| Q |
264 |
aattgtataatctaaaatattgc |
286 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44884873 |
aattgtataatctaaaatattgc |
44884851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 44885175 - 44885128
Alignment:
| Q |
19 |
tatagggcttaaagcatactagggcttaggctcaggaagggttcatgt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44885175 |
tatagggcttaaagcatactagggcttaggctcaggaagggttcatgt |
44885128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University