View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14861_low_11 (Length: 375)
Name: NF14861_low_11
Description: NF14861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14861_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 15 - 360
Target Start/End: Original strand, 18079438 - 18079798
Alignment:
| Q |
15 |
atgaagaaggttgcagttggttgtccaagggatgttcaagatggaagtggaactgttgttacgccaaggacacctttgattggtactccaagagggaagg |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18079438 |
atgaagaaggttgcagttggttctccaagggatgttcatgatggaagtggaactgttgttactccaaggacacctttgattgctactccaagagggaagg |
18079537 |
T |
|
| Q |
115 |
aagaagaaga---------------tgatgatgatgaagtgtacaagactgcagaagttgaagtgagtaaaagatctggtaagaaaaagaggaaactttg |
199 |
Q |
| |
|
||||||| || ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18079538 |
aagaagatgaagaagatgatgatgatgatgatgaagaagtgtacaagactgcagaagttgaagtgagtaagagatctggtaagaaaaagaggaaactttg |
18079637 |
T |
|
| Q |
200 |
gagttggattgagttgtttgcttttgtttgcattttagggtttttgattgcaaccttaatggttcataggttgcaacataagcaaatttggagtttggaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18079638 |
gagttggattgagttgtttgcttttgtttgcattttagggtttttgattgcaaccttattggttcataggttgcaacataaggaaatttggagtttggaa |
18079737 |
T |
|
| Q |
300 |
ctttggaaatggtgtgtgcttacattggtaattatctctggtaggttagtcactagttggt |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18079738 |
ctttggaaatggtgtgtgcttacattggtaattatctctggtagattagtcactagttggt |
18079798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University