View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14861_low_22 (Length: 302)
Name: NF14861_low_22
Description: NF14861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14861_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 52784995 - 52784714
Alignment:
| Q |
18 |
agttccagatccaatcatcgaagaggccatgaattatgcctgttggtcaggagcagactgcagttcgattcagccgaacgggccttgctttcagcccgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784995 |
agttccagatccaatcatcgaagaggccatgaattatgcctgttggtcaggagcagactgcagttcgattcagccgaacgggccttgctttcagcccgac |
52784896 |
T |
|
| Q |
118 |
agtgtatttgcacatgcttcctatgccttcaatagttactggcaaaggacgaaagcttctggtggcacttgcgagtttggagggacagccgtattagttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784895 |
agtgtatttgcacatgcttcctatgccttcaatagttactggcaaaggacgaaagcttctggtggcacttgcgagtttggagggacagccgtattagttt |
52784796 |
T |
|
| Q |
218 |
cggttgaccctagtgagtaatttaatttagtaaacttgtttggttcattttatgccaaagtaacaaactcataattgctacc |
299 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784795 |
cagttgaccctagtgagtaatttaatttagtaaacttgtttggttcattttatgccaaagtaacaaactcataattgctacc |
52784714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University