View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14861_low_26 (Length: 270)
Name: NF14861_low_26
Description: NF14861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14861_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 26753137 - 26753370
Alignment:
| Q |
13 |
ataatactcctctattttaagcaattgaatggaaggcaaaaacagttgagtcaatttcttgaaccaaagggttgccttaatataacttgattgccattaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26753137 |
ataatactcctctattttaagcaattaaatggaaggcaaaaacagttgagtcaatttcttgaaccaaagggttgccttaatataacttgattgccattaa |
26753236 |
T |
 |
| Q |
113 |
acagcagtatgccgtagtaagagaaaaatgtattattgtattcatcaatcaactagaaaaggcctcaaggttttcattatccaaatcaagagggtagttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26753237 |
acagcagtatgccgtagtaagagaaaaatgtattattgtattcatcaatcaactagaaaaggcctcaaggttttcattatccaaatcaagagggtagttc |
26753336 |
T |
 |
| Q |
213 |
agtcatttggatattgatgatgagttgtggaatc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26753337 |
agtcatttggatattgatgatgagttgtggaatc |
26753370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University