View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14861_low_29 (Length: 247)

Name: NF14861_low_29
Description: NF14861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14861_low_29
NF14861_low_29
[»] chr7 (1 HSPs)
chr7 (62-237)||(40960331-40960506)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 62 - 237
Target Start/End: Complemental strand, 40960506 - 40960331
Alignment:
62 cagtcaggtctcttatgtaaattcttgaacaaaaaatctagagcaaatgtcaggaaagagagagcaaacttgagaggaaagcagtgagaaagagatctgg 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40960506 cagtcaggtctcttatgtaaattcttgaacaaaaaatctagagcaaatgtcaggaaagagagagcaaacttgagaggaaagcagtgagaaagagatctgg 40960407  T
162 atgaggggagaagacaacaaacaatgcagatgacataaaaagagcacaatgtagcgcaaagggaccggcctgatga 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40960406 atgaggggagaagacaacaaacaatgcagatgacataaaaagagcacaatgtagcgcaaagggaccggcctgatga 40960331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University