View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14862_low_6 (Length: 234)
Name: NF14862_low_6
Description: NF14862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14862_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 48357148 - 48357027
Alignment:
| Q |
1 |
ttatatgttaaaatattgggtgtgtgactatagatagatatatggctagctagttagattggcatacttctttaatttttctctagttttgtacttgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357148 |
ttatatgttaaaatattgggtgtgtgactatagatagatatatggctagctagttagattggcatacttctttaatttttctctagttttgtacttgttt |
48357049 |
T |
 |
| Q |
101 |
atttcttaaactgaatcaaatt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48357048 |
atttcttaaactgaatcaaatt |
48357027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 160 - 217
Target Start/End: Complemental strand, 48357025 - 48356968
Alignment:
| Q |
160 |
gtcgtcaaataaatctttgttagtaaatataataaaagagaaattttctgatacttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357025 |
gtcgtcaaataaatctttgttagtaaatataataaaagagaaattttctgatacttat |
48356968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University