View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14863_high_5 (Length: 400)
Name: NF14863_high_5
Description: NF14863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14863_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 2e-59; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 19 - 135
Target Start/End: Original strand, 969296 - 969412
Alignment:
| Q |
19 |
aaactaccttcgtccagatgttagaagagggaatattacacctgaggaacaacttttgatcatggaacttcatgcaaagtggggaaataggtgaatattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
969296 |
aaactaccttcgtccagatgttagaagagggaatattacacctgaggaacaacttttgatcatggaacttcatgcaaagtggggaaataggtgaatattt |
969395 |
T |
 |
| Q |
119 |
atatgattatcattgta |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
969396 |
atatgattatcattgta |
969412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 326 - 389
Target Start/End: Original strand, 969618 - 969681
Alignment:
| Q |
326 |
cttgttatataagtaagcacaccatgagaaaagttctataaggaagaaaactttgtgcttgaga |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
969618 |
cttgttatataagtaagcacaccatgagaaaagttctataaggaagaaaactttgtgcttgaga |
969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 164 - 203
Target Start/End: Original strand, 969428 - 969467
Alignment:
| Q |
164 |
ttatatggtgcatgtgctctacctacctaactactagatc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
969428 |
ttatatggtgcatgtgctctacctacctaacaactagatc |
969467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 283 - 311
Target Start/End: Original strand, 969547 - 969575
Alignment:
| Q |
283 |
caaagatgaaagaaattcttgtttctgtc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
969547 |
caaagatgaaagaaattcttgtttctgtc |
969575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 13293279 - 13293370
Alignment:
| Q |
19 |
aaactaccttcgtccagatgttagaagagggaatattacacctgaggaacaacttttgatcatggaacttcatgcaaagtggggaaataggt |
110 |
Q |
| |
|
|||||| ||||| || ||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
13293279 |
aaactatcttcgaccggatgttagacgagggaatattacacctgaggaacaactcttgatcattgaacttcatgctaagtggggaaacaggt |
13293370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University