View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14863_high_7 (Length: 369)

Name: NF14863_high_7
Description: NF14863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14863_high_7
NF14863_high_7
[»] chr1 (1 HSPs)
chr1 (99-353)||(6698545-6698799)


Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 99 - 353
Target Start/End: Complemental strand, 6698799 - 6698545
Alignment:
99 ggaccacaggttgcaaaatcaattgagagcataatgtatcaatcaatagctagtcctaatgacccaaggaggaaggagctagagaatatggagaagcaaa 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698799 ggaccacaggttgcaaaatcaattgagagcataatgtatcaatcaatagctagtcctaatgacccaaggaggaaggagctagagaatatggagaagcaaa 6698700  T
199 aagcaatgattgatggcaaggcaaaagctcaagttcagactgagctttactgtggattgggatttttaacaatccaaacacttgggttcatgagactcac 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6698699 aagcaatgattgatggcaaggcaaaagctcaagttcagactgagctttactgtggattgggatttttaacaatccaaacacttgggttcatgagactcac 6698600  T
299 attttgggagctaagttgggatgttatggaaccaatatgtttctttgttacttcc 353  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
6698599 attttgggagctaagttgggatgttatggaaccagtatgtttctttgttacttcc 6698545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University