View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14863_high_7 (Length: 369)
Name: NF14863_high_7
Description: NF14863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14863_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 99 - 353
Target Start/End: Complemental strand, 6698799 - 6698545
Alignment:
| Q |
99 |
ggaccacaggttgcaaaatcaattgagagcataatgtatcaatcaatagctagtcctaatgacccaaggaggaaggagctagagaatatggagaagcaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6698799 |
ggaccacaggttgcaaaatcaattgagagcataatgtatcaatcaatagctagtcctaatgacccaaggaggaaggagctagagaatatggagaagcaaa |
6698700 |
T |
 |
| Q |
199 |
aagcaatgattgatggcaaggcaaaagctcaagttcagactgagctttactgtggattgggatttttaacaatccaaacacttgggttcatgagactcac |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6698699 |
aagcaatgattgatggcaaggcaaaagctcaagttcagactgagctttactgtggattgggatttttaacaatccaaacacttgggttcatgagactcac |
6698600 |
T |
 |
| Q |
299 |
attttgggagctaagttgggatgttatggaaccaatatgtttctttgttacttcc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6698599 |
attttgggagctaagttgggatgttatggaaccagtatgtttctttgttacttcc |
6698545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University