View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14863_low_11 (Length: 318)
Name: NF14863_low_11
Description: NF14863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14863_low_11 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 130 - 318
Target Start/End: Original strand, 31894777 - 31894965
Alignment:
| Q |
130 |
ggtgggagagagagaaaccttggacttcaaaggtgcatttaaggttggtttagcagaatccaaggtttctgtttctgagatgtcttcattgttttggtcc |
229 |
Q |
| |
|
|||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
31894777 |
ggtgggagagggaaaaaccttggacttcgaaggtgcatttaaggttggtttagcagaatccaaggtttccttttcaggaatgtcttcattgttttggtcc |
31894876 |
T |
|
| Q |
230 |
aactcagtgatttgaggttgagatctgaggtttctgagaacaaagaagccagcaagagtagcagacaagaatatgagaatgagtcttag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31894877 |
aactcagtgatttgaggttgagatctgaggtttctgagaacaaagaagccggcaagagtagcagacaagaatatgagaatgagtcttag |
31894965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 31894661 - 31894711
Alignment:
| Q |
14 |
atgtccaaaaccatgattctaatgcagccttaacctgttgtaaacaacaac |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31894661 |
atgtccaaaaccatgattctaatgcagccttaacctgttgtaaacaacaac |
31894711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University