View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14863_low_17 (Length: 218)
Name: NF14863_low_17
Description: NF14863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14863_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 45732533 - 45732333
Alignment:
| Q |
1 |
gtggttgaagtcgcgtaagatacttgattgatattgttgagatgtgatcaatcaaacgtggctcatgtggccttgattgcgattgcaatatgcattgcaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45732533 |
gtggttgaagtcgcgtatgatacttgattgatattgttgagatgtgatcaatcaaaagtggctcatgtggccttgattgcgattgcaatatgcattgcaa |
45732434 |
T |
 |
| Q |
101 |
tcgcagagacgtaaaaactcgacctctaagtgcaaaaagaatgcatatagaaataggtttctgagaagaagcatacatgtggatttcatcatgaagaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45732433 |
tcgcagagacgtaaaaactcgacctctaagtgcaaaaagaatgcatatagaaataggtttctgagaaggagcatacatgtggatttcatcatgaagaaac |
45732334 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
45732333 |
t |
45732333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University