View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14864_low_8 (Length: 274)
Name: NF14864_low_8
Description: NF14864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14864_low_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 274
Target Start/End: Complemental strand, 39027227 - 39026960
Alignment:
| Q |
7 |
ctatcaaacaatgttcaagggtaacttgtgtgcagtagggtcacatgggaatggagacggaatggacagctatgaacagctgggaagagggactcaacgg |
106 |
Q |
| |
|
|||| ||| |||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39027227 |
ctataaaaaaatgttaaagggtatcttgtgtgcagtagggtcacatgggaatggagaaggaatggacagctatgaacagctgggaagagggactcaacgg |
39027128 |
T |
 |
| Q |
107 |
tgtaactggaaagtcgccagtggatttaatagctagtgggaatcagccaccacgtgcccttgtgaccttctctttagtgacatgcccttataataatgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39027127 |
tgtaactggaaagtcgccagtggatttaatagctagtgggaatcagccaccacgtgcccttgtgaccttctctttagtgacatgcccttataataatgat |
39027028 |
T |
 |
| Q |
207 |
aaccctttggaacactaattttaacctaggttaattcatttgaaaattcttttgtatttttataaatt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39027027 |
aaccctttggaacactaattttaacctaggttaattcatttgaaaattcttttgtatttttataaatt |
39026960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University