View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14864_low_9 (Length: 239)
Name: NF14864_low_9
Description: NF14864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14864_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 40 - 230
Target Start/End: Original strand, 7028958 - 7029148
Alignment:
| Q |
40 |
attctgcaatgtaaaggaaacatatacaataaaccatatcaatcattagaaatagaagatgttagaaaaaagaagacatgtgccttcactcaagcatttt |
139 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7028958 |
attctgcaatgtaaaggaaatatatacaatcaaccatattaatcattagaaatagaagatgttagaaaaaagaagacatgtgccttcacttaagcatttt |
7029057 |
T |
|
| Q |
140 |
aacccttgggtttcatgcttcaggggctggatgatattatcccccagaggcaatacacgaattgagaaatcgagacaatacgtcaatgaga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7029058 |
aacccttgggtttcatgcttcaggggctggatgatattatcccccagaggcaatacacgaattgagaaatcgagacaatacgtcaatgaga |
7029148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University