View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14866_high_14 (Length: 256)
Name: NF14866_high_14
Description: NF14866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14866_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 5 - 241
Target Start/End: Original strand, 44966151 - 44966387
Alignment:
| Q |
5 |
gaatgaatctattttcagtttcagttgatatgggatcnnnnnnnggtcacactctgacgactcttcctttgtt-----gtgttgtattgtgagttttgca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
44966151 |
gaatgaatctattttcagtttcagttgatatgggatctttttttggtcacactctgacgactcttcctttgttttgttgtgttgtgttgtgagttttgca |
44966250 |
T |
 |
| Q |
100 |
ctactttgcactctgcttgaggttgtattattattaattattatctcaatcaatctctcaagtatagtattttgattagattgctatctcaaaagattca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44966251 |
gtactttgcactctgcttgaggttgtattattatta-ttatcatctcaa----tctctcaagtatagtattttgattagattgctatctcaaaagattca |
44966345 |
T |
 |
| Q |
200 |
aagtaacaatatttcgtcttgtgactgtgtgagcattgatat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44966346 |
aagtaacaatatttcgtcttgtgactgtgtgagcattgatat |
44966387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University