View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14866_low_17 (Length: 233)
Name: NF14866_low_17
Description: NF14866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14866_low_17 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 36351 - 36564
Alignment:
| Q |
1 |
ttgtttatggttttgttggttgtgtcttgggcaatgttcatttcatatatgaagatgtagtgtaatgactcagttcaaatgttaaatcaatgttatgaag |
100 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36351 |
ttgtttatggttatgttggttgtattttgggcaatgttcatttcatatatgaagatgtagtgtaatgactcggttcaaatgttaaatcaatgttatgaag |
36450 |
T |
 |
| Q |
101 |
tttatgacattgttgattgtaatgaaaagaagttgtgtttcttgaataaatgaaatgaagtttgtttgtcatgctattgttgtctgcttgttcattactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
36451 |
tttatgacattgttgattgtaatgaaaagaagttgtgtttcttgaatcaatgaaatgaagtttgtttgtcatgctattgttgtatgcttgttcattagtt |
36550 |
T |
 |
| Q |
201 |
tgtgattcactgtt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36551 |
tgtgattcactgtt |
36564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 23573673 - 23573754
Alignment:
| Q |
16 |
ttggttgtgtcttgggcaatgttcatttcatatatgaagatgtagtgtaatgactcagttcaaatgttaaatcaatgttatgaa |
99 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||| ||| |||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
23573673 |
ttggttgtatcttgggcaatgttcattacatatctgacgatgtagtgtgat--ctcggttcaaatgttaaatcaatgttatgaa |
23573754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University