View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14867_high_7 (Length: 211)
Name: NF14867_high_7
Description: NF14867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14867_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 35136866 - 35136695
Alignment:
| Q |
1 |
tggatgttcaaatatcatttctcatctaatatatagatagatggg-acaactagaaacataataagttaattgaattctctttatttatcgatcataaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35136866 |
tggatgttcaaatatcatttctcatctaatatatagatagatggggacaactagaaacataataagttaattgaattctctttatttatcgatcataaat |
35136767 |
T |
 |
| Q |
100 |
caattataattttcttttaatagccaaagaagatatattaagaagggacaaaatatactccaactcagaaag |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35136766 |
caattataattttcttttaatagccaaagaagatatattaagaagggacaaaatatactccaactcagaaag |
35136695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 24 - 102
Target Start/End: Complemental strand, 35145092 - 35145013
Alignment:
| Q |
24 |
atctaatatatagatagatggg-acaactagaaacataataagttaattgaattctctttatttatcgatcataaatcaa |
102 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35145092 |
atctaatatatagatagatggggacaactagaaacataataagttaattgaattccctttatttatcggtcataaatcaa |
35145013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 170
Target Start/End: Complemental strand, 35145010 - 35144967
Alignment:
| Q |
127 |
agaagatatattaagaagggacaaaatatactccaactcagaaa |
170 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
35145010 |
agaagatatattaagaaggaacaaaatatactccaactaagaaa |
35144967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University