View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14868_low_14 (Length: 297)
Name: NF14868_low_14
Description: NF14868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14868_low_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 297
Target Start/End: Original strand, 40997764 - 40998037
Alignment:
| Q |
19 |
tgattaaattaagctaaaaaataatattattagcaaaatagaggaagtaagtaagagaaaattaaagagatatattatatgtggtttatttttnnnnnnn |
118 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40997764 |
tgattgaattaagctaaaaaataatattattagcaaaatagaggaagtaagtaagagaaaattaaagagatatattatatgtggtttatttttaaaataa |
40997863 |
T |
|
| Q |
119 |
nnnnnnttataattttttaatggtgattattattgtttatatatttctgcgaaatgagcactgctctcttggtttttgaatcaaacatgaagaatcaaga |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40997864 |
aa----ttgtaattttttaatggtgattattattgtttatatatttctgcgaaatgagcactgctctcttggtttttgaatcaaacatgaagaatcaaga |
40997959 |
T |
|
| Q |
219 |
ttcagtctatgagtcattgcaacgtaaaataaatgatatgttatgtaatcttttaatgcatagacaaatcatcacaatg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40997960 |
ttcagtctatgagtcattgcaacgtaaaataaatgatatgttctgtaat-ttttaatgcatagacaaatcatcacaatg |
40998037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University