View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_high_20 (Length: 247)
Name: NF14869_high_20
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 32670045 - 32670283
Alignment:
| Q |
9 |
acatcatcatcttcacattacaatattcctcaagatatgtctccgaaatcaattcaaagagttgctgcagctgccgcgaatagtttcattgacaacaata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32670045 |
acatcatcatcttcacattacaatattcctcaagatatgtctccaaaatcaattcaaagagtagctgcagctgccgcgaatagtttcatcgacaacaata |
32670144 |
T |
 |
| Q |
109 |
at------------------gtcaatgataatgctaacactccctcttcatcatcattggtatcatctccatcatcaatggtttcttctgacgatgtttc |
190 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670145 |
ataataatgttaatgttaatgtcaatgataatgctaacactccctcttcatcatcattggtatcatctccatcatcaatggtttcttctgacgatgtttc |
32670244 |
T |
 |
| Q |
191 |
ttcacttatgtcatctttcgatcaagttaatgatgaatc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670245 |
ttcacttatgtcatctttcgatcaagttaatgatgaatc |
32670283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University