View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_high_23 (Length: 236)
Name: NF14869_high_23
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 42022678 - 42022898
Alignment:
| Q |
1 |
caaataatgatataaactatcacaaaagtagctttaa------ccgcgagattgtaaaggatatagacccaaataatgattcaaactcaacattatgagt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42022678 |
caaataatgatataaactatcacaaaagtagctttaattataaccgggagattgtaaaggatatagacccaaataatgattcaaactcaacattatgagt |
42022777 |
T |
|
| Q |
95 |
ggtaaatctacttttttggcaagatacatgtccatgatgcatatgcaaagtggcaagttggatgcattaacaaagttgcaagatgaatgagatgcaaacg |
194 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42022778 |
gataaatctacttttttggcaagatacatgtccatgatgc--atgcaaagtggaaagttggatgcattaacaaagttgcaagaagaatgagatgcaaacg |
42022875 |
T |
|
| Q |
195 |
acattttgcacacttgtgtatag |
217 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42022876 |
acattttgcacacttgtgtatag |
42022898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University