View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_high_25 (Length: 214)
Name: NF14869_high_25
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_high_25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 37338168 - 37337955
Alignment:
| Q |
1 |
gacattgtgctcctcatatatagtcggggacttgccacaattctcttagcagatgctcccattatatatgctgtattcttaggtttcatattaacgtggc |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37338168 |
gacattgtgctcctcatatatagttcgggacttgccacaattctcttagcagatgctcccattatatatgctgtattcttaggtttcatattaacgtgac |
37338069 |
T |
 |
| Q |
101 |
tttttataggagacaaatgtttgttgtgagtatatgaaatgggtttagcagactttgaaaacaaagtttcattttgaaatcttttcattgctgtatttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37338068 |
tttttataggagacaaatgtttgttgtgagtaactgaaatgggtttagcagactttgaaaacaaagtttcattttgaaatcttttcattgttgtatttcc |
37337969 |
T |
 |
| Q |
201 |
cactttatgagcct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37337968 |
cactttatgagcct |
37337955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University