View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_high_27 (Length: 203)
Name: NF14869_high_27
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26200686 - 26200573
Alignment:
| Q |
2 |
tgtacattgttaaaagaaaatcaaaagaaattcgttgtctacat--gttgtcaaaagaaattcgttgagtgcatgagtcaaaagaattcagttgagtgta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26200686 |
tgtacattgttaaaagaaaatcaaaagaaattcgttgtctacatatgttgtcaaaagaaattcgttgagtgcatgagtcaaaaaaattcagttgagtgta |
26200587 |
T |
|
| Q |
100 |
taaaaagaaagcac |
113 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26200586 |
taaaaagaaagcac |
26200573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 186
Target Start/End: Complemental strand, 26168475 - 26168422
Alignment:
| Q |
133 |
aaaagaaagcaccgtttgttaaatccagagttagcttctctaaagcaaagattg |
186 |
Q |
| |
|
|||||||||||||||||||||||| || |||| |||||||||||||| |||||| |
|
|
| T |
26168475 |
aaaagaaagcaccgtttgttaaattcacagtttgcttctctaaagcatagattg |
26168422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University