View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_high_7 (Length: 418)
Name: NF14869_high_7
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 365 - 400
Target Start/End: Original strand, 35918850 - 35918885
Alignment:
| Q |
365 |
ttccatagtgtttcttgacattaattacagaaaatc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35918850 |
ttccatagtgtttcttgacattaattacagaaaatc |
35918885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 211 - 256
Target Start/End: Complemental strand, 35543738 - 35543693
Alignment:
| Q |
211 |
gttaacagttattgatcagttggcagttttctgttatggtatagtt |
256 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
35543738 |
gttaacagctattgattagttggtagttttctgttatggtatagtt |
35543693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 211 - 256
Target Start/End: Complemental strand, 35561480 - 35561435
Alignment:
| Q |
211 |
gttaacagttattgatcagttggcagttttctgttatggtatagtt |
256 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
35561480 |
gttaacagctattgattagttggtagttttctgttatggtatagtt |
35561435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 268
Target Start/End: Original strand, 34989409 - 34989449
Alignment:
| Q |
228 |
agttggcagttttctgttatggtatagttgatcagttagaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34989409 |
agttggcagttttctgttatggtatagttgattggttagaa |
34989449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 211 - 253
Target Start/End: Complemental strand, 35530300 - 35530258
Alignment:
| Q |
211 |
gttaacagttattgatcagttggcagttttctgttatggtata |
253 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35530300 |
gttaacagctattgattagttggtagttttctgttatggtata |
35530258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 275
Target Start/End: Original strand, 35887109 - 35887163
Alignment:
| Q |
219 |
ttattgatcagttggcagttttctgttatggtatagttgatcagttagaagcagtta |
275 |
Q |
| |
|
||||||||||||||| | ||||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
35887109 |
ttattgatcagttggaacttttcagttatggtat--ttgattagttagaagcagtta |
35887163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University