View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_low_16 (Length: 266)
Name: NF14869_low_16
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 154 - 256
Target Start/End: Original strand, 32782122 - 32782224
Alignment:
| Q |
154 |
attgataaaaaagagtagcaactatagctatttatgcgactgcagacaatttgtttttataaaactttcctgccacttatttggacccattttttactat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32782122 |
attgataaaaaagagtagcaactatagctatttatgcgactgcagacaatttgtttttataaaactttcctgccacttatttggacccattttttactat |
32782221 |
T |
|
| Q |
254 |
att |
256 |
Q |
| |
|
||| |
|
|
| T |
32782222 |
att |
32782224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 32782015 - 32782087
Alignment:
| Q |
19 |
aaggtggactcatttgtgaatgtgaacaaaaatgtatgtattaaccatccaactgaccaaagatgtataacga |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32782015 |
aaggtggactcatttgtgaatgtgaacaaaaatgtctgtattaaccatccaactgaccaaagatgtataacga |
32782087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University