View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_low_22 (Length: 241)
Name: NF14869_low_22
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 6014133 - 6014351
Alignment:
| Q |
9 |
catcagaaaataccttattttcaccattgtttccctctcagcaccaatgtcctacgctcacaacgttttcacattgttatataacccaaatgtttttact |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6014133 |
catcggaaaataccttattttcaccattgtttccctctcagcaccaatgtcctacgctcacaacgttttcacattgttatataacccaaatgtttttact |
6014232 |
T |
|
| Q |
109 |
tggaacactatgattcgagggtacgctgaaagtgataactcaacacctgcacttggtttgtatcgtaaaatgttgggttcatgtgttgaacctgatactc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6014233 |
tggaacactatgattcgagggtacgctgaaagtgataactcaacacctgcacttggtttgtatcgtaaaatgttgggttcatgtgttgaacctgatactc |
6014332 |
T |
|
| Q |
209 |
acacttacccttttcttct |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6014333 |
acacttacccttttcttct |
6014351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University