View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_low_27 (Length: 208)
Name: NF14869_low_27
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 2451229 - 2451403
Alignment:
| Q |
19 |
tatagacttgcttatacctatggtatatatagacatggattttgagcgcccattaataaacaattcacgtttgttttccaatcatcttggtcttagctag |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451229 |
tatatacttgcttatacctatggtatatatagacatggattttgagcgcccattaataaacaattcacgtttgttttccaatcatcttggtcttagctag |
2451328 |
T |
|
| Q |
119 |
gtatgaagtgaaaattggaaaacaagaacaaattttcaattgttctctcttctaaggtccctttcaccttctgtg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451329 |
gtatgaagtgaaaattggaaaacaagaacaaattttcaattgttctctcttctaaggtccctttcaccttctgtg |
2451403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 114 - 157
Target Start/End: Original strand, 23729998 - 23730041
Alignment:
| Q |
114 |
gctaggtatgaagtgaaaattggaaaacaagaacaaattttcaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23729998 |
gctaggtatgaagtgaaaattggaaaacaagaacaaattttcaa |
23730041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University