View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14869_low_28 (Length: 207)
Name: NF14869_low_28
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14869_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 67 - 189
Target Start/End: Original strand, 32670161 - 32670283
Alignment:
| Q |
67 |
taatgtcaatgataatgctaacactccctcttcatcatcattggtatcatctccatcatcaatggtttcttctgacgatgtttcttcacttatgtcatct |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670161 |
taatgtcaatgataatgctaacactccctcttcatcatcattggtatcatctccatcatcaatggtttcttctgacgatgtttcttcacttatgtcatct |
32670260 |
T |
 |
| Q |
167 |
ttcgatcaagttaatgatgaatc |
189 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32670261 |
ttcgatcaagttaatgatgaatc |
32670283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 32670095 - 32670146
Alignment:
| Q |
19 |
aattcaaagagttgctgcagctgccgcgaatagtttcattgacaacaataat |
70 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32670095 |
aattcaaagagtagctgcagctgccgcgaatagtttcatcgacaacaataat |
32670146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University