View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1486_high_16 (Length: 335)
Name: NF1486_high_16
Description: NF1486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1486_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 102 - 252
Target Start/End: Complemental strand, 2104563 - 2104413
Alignment:
| Q |
102 |
gatttaggtattttgatattgcaaatatttcttacccttaacaaatgtgtataaacattttaggtgggtgcatccttcataaatattttagtaaagacat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2104563 |
gatttaggtattttgatattgcaaatatttcttacccttaacaaatgtgtataaacattttaggtgggtacatccttcataaatattttagtaaagacat |
2104464 |
T |
 |
| Q |
202 |
tctcaacaatatgttggccacaaatactaaaataaaatcttcgtcaacata |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2104463 |
tctcaacaatatgttggccacaaatactaaaataaaatcttcgtcaacata |
2104413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 115
Target Start/End: Complemental strand, 2104678 - 2104579
Alignment:
| Q |
16 |
gttgtgtcctatgatagactagtaacgtggctgatgcatattttcattcggtttatttaatttagatgtttgctttttaccaagttgatttaggtatttt |
115 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2104678 |
gttgtgtactatgatagaccagtaacgtggctgatgcatattttcattcggtttatttaatttagatgtttgctttttaccaagttgatttaggtttttt |
2104579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 211
Target Start/End: Complemental strand, 2085409 - 2085375
Alignment:
| Q |
177 |
ttcataaatattttagtaaagacattctcaacaat |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
2085409 |
ttcataaatattttagtaaagacactctcaacaat |
2085375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 35 - 79
Target Start/End: Complemental strand, 2085811 - 2085767
Alignment:
| Q |
35 |
tagtaacgtggctgatgcatattttcattcggtttatttaattta |
79 |
Q |
| |
|
||||||||||||||||||| | |||| |||| ||||||||||||| |
|
|
| T |
2085811 |
tagtaacgtggctgatgcaaaatttcgttcgatttatttaattta |
2085767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University