View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1486_high_28 (Length: 248)
Name: NF1486_high_28
Description: NF1486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1486_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 13858743 - 13858970
Alignment:
| Q |
1 |
ctaatagtcatcgtagatcattgccattatcagtcctttctactaataatttgcccattgatgcgcttgttgttgctgctaatcgaactctgttgcctgt |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13858743 |
ctaatagtcatcgtatatcattgccatcatcagtcctttctgctaataatatgcccattgatgcgcttgttgttgctgctaatcgaactctgttgcctgt |
13858842 |
T |
 |
| Q |
101 |
tgtatactatccaaggtatatttaatttgctctaagccttgcctaaccaaggttaatttatagtataacaaatacaaacttttggattaggatatacttt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13858843 |
tgtatactatccagggtatatttaatttgctctaagccttgcctaaccaaggttaatttatagtataacaaatacaaacttttggattaggatatacttt |
13858942 |
T |
 |
| Q |
201 |
tcttgagtgtaatgtctgtttcttctca |
228 |
Q |
| |
|
||||||||||||||| ||||||| |||| |
|
|
| T |
13858943 |
tcttgagtgtaatgtttgtttctgctca |
13858970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University