View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1486_high_29 (Length: 240)
Name: NF1486_high_29
Description: NF1486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1486_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 37122886 - 37122701
Alignment:
| Q |
1 |
aaatatatctttattgattaatttcataatatgcaacattt-ctttttctaacttcannnnnnnnnnnnggtgacaaattttccaacaaattcttaataa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
37122886 |
aaatatatctttattgattaatttcataatatgcaacatttactttttctaacttcatttttttttt----tgacattttttccaacaaattct-aataa |
37122792 |
T |
|
| Q |
100 |
caccggattctgctgcctgcgtttttaatctttcatttatttgttttgtgggaaactgatattttactaccattaaattcactaatgtttt |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37122791 |
caccggattctggtgcctgcgtttttaatctttcatttatttgttttgtgggaaactgatattttactaccattaaattcactaatgtttt |
37122701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 174 - 226
Target Start/End: Complemental strand, 37122688 - 37122636
Alignment:
| Q |
174 |
aaattcactaatgttttgtatagttatcttttttattatggtataatatcctg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37122688 |
aaattcactaatgttttgtatagttatcttttttattatggtataatatcctg |
37122636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 73 - 225
Target Start/End: Complemental strand, 37112603 - 37112446
Alignment:
| Q |
73 |
acaaattttccaacaaattcttaataacaccggattctgctgcctgcgtttttaatctttcatttatttgttttgtgggaaactgatattttactaccat |
172 |
Q |
| |
|
|||| ||||| ||| ||||||||||||| | |||||||||| |||||||||| || |||| | ||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
37112603 |
acaatttttctaacgaattcttaataactctggattctgctacctgcgttttaaaccttttgtctatttgtttcgtgggaaaccgatactttactaccat |
37112504 |
T |
|
| Q |
173 |
----taa-attcactaatgttttgtatagttatcttttttattatggtataatatcct |
225 |
Q |
| |
|
||| ||||||| |||||||||||||| | |||| ||| ||||| |||||||| |
|
|
| T |
37112503 |
aagataatattcacttgtgttttgtatagttttaattttgattctggtacaatatcct |
37112446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University