View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1486_low_26 (Length: 285)
Name: NF1486_low_26
Description: NF1486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1486_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 39135710 - 39135639
Alignment:
| Q |
21 |
tgtaaacttttcaagtatacatatttaatagctctaacattacatgatattgatttactctacagatagcat |
92 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135710 |
tgtaaacttttcaagtatacacatttaatagctctaacattacatgatattgatttactctacagatagcat |
39135639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 141 - 198
Target Start/End: Complemental strand, 39135595 - 39135538
Alignment:
| Q |
141 |
gtggaggtttttaccaagtagttccatttgtgaaggttgaaatgaaagctttgtgtta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135595 |
gtggaggtttttaccaagtagttccatttgtgaaggttgaaatgaaagctttgtgtta |
39135538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 230 - 270
Target Start/End: Complemental strand, 19805881 - 19805841
Alignment:
| Q |
230 |
gagtaaaccctagaagagaaaaatggaaaaggggtagttag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
19805881 |
gagtaaaccctagaagagaaaaatggaaaaagtgtagttag |
19805841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 19806061 - 19806009
Alignment:
| Q |
22 |
gtaaacttttcaagtatacatatttaatagctctaacattacatgatattgat |
74 |
Q |
| |
|
|||||||||||||||||||| |||||||| || |||||| |||||||||||| |
|
|
| T |
19806061 |
gtaaacttttcaagtatacacatttaataacttaaacattgcatgatattgat |
19806009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University