View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1486_low_29 (Length: 259)

Name: NF1486_low_29
Description: NF1486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1486_low_29
NF1486_low_29
[»] chr5 (1 HSPs)
chr5 (1-231)||(13858561-13858790)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 13858790 - 13858561
Alignment:
1 tattagtagaaaggactgatgatggcaatgatatacgatgactattagcacgccagaccccagctagcaattgtgatttctcatcccttgtaacaattga 100  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||| ||||||||||||||||||    
13858790 tattagcagaaaggactgatgatggcaatgatatacgatgactattagca-gcctgaccccaactagcaattgtgatttctaatcccttgtaacaattga 13858692  T
101 catttcatatcttcagtacaaagaaagtttcaaaagtcttaacctaatgggatgatttctcaacttaccttaaataattttcacaaaatcttgattatat 200  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13858691 catttcatatcttcaatacaaagaaagtttcaaaagtcttaacctaatgggatgatttctcaacttaccttaaataattttcacaaaatcttgattatat 13858592  T
201 tgtgtaatggcacattggtcagagtagcatt 231  Q
    ||||||||||||||||||||||||| |||||    
13858591 tgtgtaatggcacattggtcagagtggcatt 13858561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University