View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14870_low_3 (Length: 427)
Name: NF14870_low_3
Description: NF14870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14870_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 331
Target Start/End: Original strand, 38304160 - 38304471
Alignment:
| Q |
15 |
cacagattcgacggtgtatgagattcctgtagtacgaaacgcatacgatacgacgatgcgaggtggggtaggaacttggtgacgttcatggtatggaagg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38304160 |
cacagattcgacggtgtatgagattcctgcagtacgaaacgcatac-----gacgatgcgaggtggggtaggaacttggtgacgttcatggtatggaagg |
38304254 |
T |
|
| Q |
115 |
cgatgtatatgggttggttgtgtcccgcggcgagtagtgatgttctattatggagaggttggctgaaaatttgattttaagtagccattgatggtgtttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38304255 |
cgatgtatatgggttggttgtgtcccgcggcgagtagtgatgttctattatggagaggttggctgaaaatttgattttaagtagctattgatggtgtttt |
38304354 |
T |
|
| Q |
215 |
aattagnnnnnnnncgatgaaggtggtggtagattggagaagaataccaatggaattgctattgatttctcataatgagatggctgataaaagacaaaaa |
314 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38304355 |
aattagaaaaaaaacgatgaaggtggtggtagattggagaagaatactattggaattgctattgatttctcataatgagatggctgataaaagacaaaaa |
38304454 |
T |
|
| Q |
315 |
agtgaaaccaagagtta |
331 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38304455 |
agtgaaaccaagagtta |
38304471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 146 - 220
Target Start/End: Complemental strand, 44166540 - 44166466
Alignment:
| Q |
146 |
gagtagtgatgttctattatggagaggttggctgaaaatttgattttaagtagccattgatggtgttttaattag |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
44166540 |
gagtagtgatgttctgttatggagaggttggctgcaaatttgagcttaagtagttattgatggtgttttaattag |
44166466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 148
Target Start/End: Complemental strand, 44166659 - 44166615
Alignment:
| Q |
104 |
ggtatggaaggcgatgtatatgggttggttgtgtcccgcggcgag |
148 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44166659 |
ggtatggaaggcggtgtatatgcgttggttgtgtcccgcggcgag |
44166615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 236 - 290
Target Start/End: Complemental strand, 44166441 - 44166387
Alignment:
| Q |
236 |
ggtggtggtagattggagaagaataccaatggaattgctattgatttctcataat |
290 |
Q |
| |
|
||||||||| ||||||||||||| |||| || |||||||||| |||||||||||| |
|
|
| T |
44166441 |
ggtggtggttgattggagaagaagaccattgaaattgctattaatttctcataat |
44166387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University