View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14871_high_17 (Length: 312)
Name: NF14871_high_17
Description: NF14871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14871_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 10 - 177
Target Start/End: Original strand, 32809087 - 32809244
Alignment:
| Q |
10 |
cctgtttaccgattccacccatgcccaaggttacagccttgacggtcaatgcacaccttgcctccaacggtgttgtgttctccttgtcgtgaggatcctc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
32809087 |
cctgtttaccgattccacccatgcccaaggttgcagcctt---------tgcacaccttgcctccaacggtgttgtggtctccttgtcgtgaggctcctc |
32809177 |
T |
|
| Q |
110 |
catacttgagnnnnnnngttgaagcaaaataacttgaccatgtgagtctctcacattgtggcatatat |
177 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32809178 |
catacttgag-aaaaaggttgaagcaaaataacttgaccatgtgagtctctcacattgtggtatatat |
32809244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 10 - 118
Target Start/End: Original strand, 32275344 - 32275452
Alignment:
| Q |
10 |
cctgtttaccgattccacccatgcccaaggttacagccttgacggtcaatgcacaccttgcctccaacggtgttgtgttctccttgtcgtgaggatcctc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
32275344 |
cctgtttaccgattccacccatgcccaagcttgcagccttgacggtcattgcacaccttgcctccaacggtgttgggttctccttgtcgtgaggctcctc |
32275443 |
T |
|
| Q |
110 |
catacttga |
118 |
Q |
| |
|
||||||||| |
|
|
| T |
32275444 |
catacttga |
32275452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 10 - 119
Target Start/End: Original strand, 32269036 - 32269144
Alignment:
| Q |
10 |
cctgtttaccgattccacccatgcccaaggttacagccttgacggtcaatgcacaccttgcctccaacggtgttgtgttctccttgtcgtgaggatcctc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32269036 |
cctgtttaccgattccacccatgcccaaggttgcaaccttgacggtcattgcacac-ttgcctccaacggtgttgtgttctctttgtcgtgaggctcctc |
32269134 |
T |
|
| Q |
110 |
catacttgag |
119 |
Q |
| |
|
|||||||||| |
|
|
| T |
32269135 |
catacttgag |
32269144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 32809241 - 32809277
Alignment:
| Q |
187 |
atatatttgtaagattggtgagaggcagataaatgat |
223 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32809241 |
atatatttgtaagattggtgagagggagataaatgat |
32809277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 32269167 - 32269212
Alignment:
| Q |
178 |
cacatgggaatatatttgtaagattggtgagaggcagataaatgat |
223 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
32269167 |
cacatgggtataaatttgtaagactggtgagagggagataaatgat |
32269212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University