View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14871_high_18 (Length: 309)
Name: NF14871_high_18
Description: NF14871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14871_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 194 - 264
Target Start/End: Complemental strand, 35702279 - 35702209
Alignment:
| Q |
194 |
gtgtctagtttgacttgatgattaaaattagaatatgttgtacagtattaaatagaaagaagaaaagaatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702279 |
gtgtctagtttgacttgatgattaaaactagaatatgttgtacagtattaaatagaaagaagaaaagaatt |
35702209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 35702465 - 35702425
Alignment:
| Q |
19 |
atcaagaagtaagcttgaaaattaactaaaaccaatatctg |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702465 |
atcaagaagtaagcttgaaaattaactaaaaccaatatctg |
35702425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 59
Target Start/End: Complemental strand, 35723083 - 35723046
Alignment:
| Q |
22 |
aagaagtaagcttgaaaattaactaaaaccaatatctg |
59 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
35723083 |
aagaactaagcttgaaaattaagtaaaaccaatatctg |
35723046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University