View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14871_high_25 (Length: 235)
Name: NF14871_high_25
Description: NF14871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14871_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 3884016 - 3884244
Alignment:
| Q |
1 |
ccaacccttgcgggttagatttttccaaacttgttgatttgccataaagtgtgcatgaatttattgattttccaaacctacactatcaattatatcttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884016 |
ccaacccttgcgggttagatttttccaaacttgttgatttgccataaagtgtgcatgaatttattgattttccaaacctacactatcaattatatcttga |
3884115 |
T |
|
| Q |
101 |
ttttaagaggatgcattggattatacaaggagtctctaggttaaaaataagatatatctctcatcttttagccaaatttggttctttttgcagtataatt |
200 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884116 |
ttttaagtggacgcattggattatacaaggagtctctaggttaaaaataagatatatctctcatcttttagccaaatttggttctttttgcagtataatt |
3884215 |
T |
|
| Q |
201 |
ttttatgcgctgattttctcagttatatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3884216 |
ttttatgcgctgattttctcagttatatt |
3884244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 195
Target Start/End: Original strand, 3872836 - 3872867
Alignment:
| Q |
164 |
tcttttagccaaatttggttctttttgcagta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3872836 |
tcttttagccaaatttggttctttttgcagta |
3872867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University