View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14871_high_26 (Length: 234)
Name: NF14871_high_26
Description: NF14871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14871_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 1310668 - 1310870
Alignment:
| Q |
13 |
caccacagaccattgatcttgttctccttactaaacggtattatttgtatctctttatgtttccgacacttctgatacaaggtgtgtctgtgtccaaaca |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1310668 |
caccacaaaccattgatcttgttctccttactaaacggtattatttgtatctctttatgtttccgacacttctgatacaaggtgtgtctgtgtccaaaca |
1310767 |
T |
 |
| Q |
113 |
cgtca---nnnnnnnnaaattacaaacgatgtactgttgatgtgttagtgttagtgtcagtgtccggtgttcatgttctgcgtcaatgcttgagattaag |
209 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1310768 |
cgtcatttttttttttaaattacaaacgatttactgttgatgtgttagtgt-------cgtgtccggtgttcatgctctgcgtcaatgcttgagattaag |
1310860 |
T |
 |
| Q |
210 |
ggtttatatt |
219 |
Q |
| |
|
| ||||||| |
|
|
| T |
1310861 |
gtgttatatt |
1310870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University