View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14871_low_34 (Length: 215)
Name: NF14871_low_34
Description: NF14871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14871_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 29679311 - 29679495
Alignment:
| Q |
15 |
aatattttggtagttcataacctgaaaaacaacttattctcagcaaatcaacttaataatggttttatttttgaatttaagttggattgttttgttatta |
114 |
Q |
| |
|
|||||||||||| | |||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
29679311 |
aatattttggtaatccataaccttaaaaagaacttattctcagcaaatcaacttaataatgattttatttttgaatttaactcggattgttttgttatta |
29679410 |
T |
|
| Q |
115 |
aagattgaaatcaaaggattttaaacgaaggacataaa-aaggcaaactctatgcactgacggggaaacttttgaagctctctct |
198 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29679411 |
aggatagaaatcaaaggattttaaacgaaggacataaacaaggcaaactctatgcattgacggggaaacttttgaagctctctct |
29679495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University