View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14872_low_4 (Length: 258)
Name: NF14872_low_4
Description: NF14872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14872_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 21 - 120
Target Start/End: Complemental strand, 38826221 - 38826122
Alignment:
| Q |
21 |
ttggtatgtctacttgttgcactagatcaatgaaagcttcatccgttagttttttgttaactttttgatcttattttgtagcgttgaccatgctcattgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38826221 |
ttggtatgtctacttgttgcactagatcaatgaaagcttcatccgttagttttttgttaactttttgatcttattttgtagcgttgaccatgttcattgc |
38826122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 116 - 230
Target Start/End: Complemental strand, 38821078 - 38820964
Alignment:
| Q |
116 |
attgccattagtatcccattctttggttctcttcttggattcctcggtgggtttgccttagccccaacaagttacttcgtaagcaaaccannnnnnncat |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38821078 |
attgccattagtgtcccattctttggttctcttcttggattcctcggagggtttgccttagccccaacaagttacttcgtaagcaaaccatttttttcat |
38820979 |
T |
 |
| Q |
216 |
actatcttattcaat |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38820978 |
actatcttattcaat |
38820964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University