View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14873_low_3 (Length: 291)
Name: NF14873_low_3
Description: NF14873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14873_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 275
Target Start/End: Original strand, 38983525 - 38983791
Alignment:
| Q |
9 |
tgaatggaaagaaacatgcttctaacacatccaatgctttcaaaatcgtatttttcaagaaacaaggtggacttgatgtgcatagcaagaaaaatcttgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38983525 |
tgaatggaaagaaacatgcttctaacacatccaatgctttcaaaatcgtatttttcaagaaacaaggtggacttgatgtgcatagcaagaaaaatcctgc |
38983624 |
T |
 |
| Q |
109 |
aagtgcgattctcaatgttgaagaaattgctactgattatgttcatcatgagattcctcagtctgagatcgttcctgctgactctatcaatatcagtaaa |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38983625 |
aagtgggattctcaatgttgaagaaattgctactgattatgttcatcatgagattcctcagtctgagatcgttcctgccgactctatcaatatcagtaaa |
38983724 |
T |
 |
| Q |
209 |
tccatcaactctcggatggaacttgaaaaccggcctttctctactcaaaagaatctagagaatgaag |
275 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38983725 |
tccactgactctcggatggaacttgaaaaccggcctttctctactcaaaagaatctagagaatgaag |
38983791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University